random sequence sirna oligonucleotides  (Thermo Fisher)

Journal: bioRxiv

Article Title: EWSR1::ETS-low cells promote metabolic reprogramming of the tryptophan-kynurenine-AHR axis, immunosuppression, and poor outcome in Ewing sarcoma

doi: 10.1101/2025.05.16.654502

Figure Lengend Snippet: a) Contingency table showing distribution of IPASS score and AHR activity score-based clusters in EwS tumors (n=166). Two-tailed Fisher’s exact test. b) Comparative analysis of inferred pro-inflammatory immune cell infiltration and c) immunosuppressive MDSCs and regulatory T cells infiltration between AHR-low (K1) and -high (K2) activity scoring EwS tumors. Horizontal bars represent the mean and whiskers the SEM. P -values were determined by Wilcoxon test. n=166. d) Relative cell viability MHH-ES-1/TR/shEF1 and TC-106/TR/shERG and e) fold change of interferon (IFN)-γ levels of MHH-ES-1/TR/shEF1 after 24 h co-culture with NK-92 cells. Horizontal bars represent the mean and whiskers the SEM. n=5 independent biological experiments. P- values were determined by two-tailed Mann-Whitney test. f) Relative AHR mRNA and g ) protein expression after establishing single cell clones with independent DOX-inducible shRNA targeting AHR (255, 286) in MHH-ES-1/TR/ and TC-106/TR/ cells (AU = arbitrary units). n=4−6 biologically independent experiments. Relative densitometry is shown, calculated from western blots of lysates from n=4 biologically independent experiments. Two-tailed Mann-Whitney test. h) Relative cell viability MHH-ES-1/TR/shAHR255 bulk and single clone #4 after 24 h co-culture with NK-92 cells. Horizontal bars represent the mean and whiskers the SEM, n=6 biologically independent experiments. P -values were determined by two-tailed Mann-Whitney test.

Article Snippet: AHR silencing (transcript ID: Human NM_001621.5) was achieved by cloning the shRNA oligonucleotide sequences into the Tet-pLKO-puro backbone (Addgene #21915, USA).

Techniques: Activity Assay, Two Tailed Test, Co-Culture Assay, MANN-WHITNEY, Expressing, Clone Assay, shRNA, Western Blot

Journal: Cell Communication and Signaling : CCS

Article Title: Chemo-proteomics reveals dihydrocaffeic acid exhibits anti-inflammation effects via Transaldolase 1 mediated PERK-NF-κB pathway

doi: 10.1186/s12964-024-01958-3

Figure Lengend Snippet: TALDO1 is identified as the potential target of DA. ( A ) Pull-down assay followed by western blot (up) and recombinant TALDO1 labeled by DA-P with DA (down). ( B ) Immunofluorescence staining of TALDO1 (green) and DA-P click-conjugated to a TAMRA dye (red). Scale bar = 25 μm. ( C ) CETSA-WB and statistical analysis of the protein levels, n = 3

Article Snippet: In this topic, complementary oligonucleotides sequences of SiRNA against TALDO1 (GGCAAACACCGACAAGAAATT) were designed and characterized by Ribobio.

Techniques: Pull Down Assay, Western Blot, Recombinant, Labeling, Immunofluorescence, Staining

Journal: Cell Communication and Signaling : CCS

Article Title: Chemo-proteomics reveals dihydrocaffeic acid exhibits anti-inflammation effects via Transaldolase 1 mediated PERK-NF-κB pathway

doi: 10.1186/s12964-024-01958-3

Figure Lengend Snippet: DA covalently binds to Cys250 of TALDO1 and influenced its enzymatic activity. ( A ) Elisa analysis of enzymatic activity of TALDO1 treated with different concentrations DA-P in RAW 264.7 cells, n = 5. ( B ) Elisa analysis of content of TALDO1 treated with different concentrations DA-P in RAW 264.7 cells, n = 5. ( C ) Labeling of TALDO1 with DA-P and with or without of IAA competitor. ( D ) Labeling of TALDO1 with IAA-yne and with or without DA competitor. ( E ) Molecular docking model of DA with TALDO1. ( F ) Characterization of binding sites of DA on purified recombinant TALDO1 protein. ** p < 0.01, *** p < 0.001 vs. control

Article Snippet: In this topic, complementary oligonucleotides sequences of SiRNA against TALDO1 (GGCAAACACCGACAAGAAATT) were designed and characterized by Ribobio.

Techniques: Activity Assay, Enzyme-linked Immunosorbent Assay, Labeling, Binding Assay, Purification, Recombinant, Control

Journal: Cell Communication and Signaling : CCS

Article Title: Chemo-proteomics reveals dihydrocaffeic acid exhibits anti-inflammation effects via Transaldolase 1 mediated PERK-NF-κB pathway

doi: 10.1186/s12964-024-01958-3

Figure Lengend Snippet: DA inhibited LPS-induced inflammatory response through PERK-NF-κB pathway. ( A ) Western blot analysis and densitometry analysis of TNF-α, p-PERK, IκBα and NF‐κB p65 expressions in cells treated with DA, n = 3, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. model group. ( B - C ) The release of NO ( B ) as well as inflammatory cytokines ( C ) in RAW 264.7 cells with DA and TALDO1 SiRNA, n = 5. ( D ) Elisa assay of enzymatic activity in LPS-treated RAW 264.7 cells after treated with DA and TALDO1 SiRNA, n = 5. ( E ) Western blot analysis and densitometry analysis results of TALDO1, TNF-α, p-PERK, IκBα and NF-κB-p65 proteins in LPS-triggered RAW 264.7 cells transfected with SiRNA and DA, n = 3. ns, not significant, * p < 0.05, ** p < 0.01, *** p < 0.001

Article Snippet: In this topic, complementary oligonucleotides sequences of SiRNA against TALDO1 (GGCAAACACCGACAAGAAATT) were designed and characterized by Ribobio.

Techniques: Western Blot, Enzyme-linked Immunosorbent Assay, Activity Assay, Transfection

Journal: Cell Communication and Signaling : CCS

Article Title: Chemo-proteomics reveals dihydrocaffeic acid exhibits anti-inflammation effects via Transaldolase 1 mediated PERK-NF-κB pathway

doi: 10.1186/s12964-024-01958-3

Figure Lengend Snippet: Structural illustration of dihydrocaffeic acid exhibiting anti-inflammation effects via Transaldolase 1 mediated PERK-NF-κB pathway revealed by activity-based protein profiling technology

Article Snippet: In this topic, complementary oligonucleotides sequences of SiRNA against TALDO1 (GGCAAACACCGACAAGAAATT) were designed and characterized by Ribobio.

Techniques: Activity Assay

Journal: Cell Communication and Signaling : CCS

Article Title: Activity-based chemical proteomics reveals caffeic acid ameliorates pentylenetetrazol-induced seizures by covalently targeting aconitate decarboxylase 1

doi: 10.1186/s12964-024-01739-y

Figure Lengend Snippet: Validation of the interaction between ACOD1 and CA. (A) CA-P pull-down experiment in LPS-induced BV2 cells followed by western blot. (B) CA-P labeling of recombinant ACOD1, n = 3, ns, not significant, *** p < 0.001. (C) Immunofluorescence staining and statistical analysis in LPS-treated BV2 cells with antibodies against ACOD1 (green) and TAMRA click CA-P (red), scale bar = 10 μm. Control: DMSO; Probe: CA-P (50 µM), Competion, CA (400 µM) and CA-P (50 µM). (D) Scheme of CETSA-WB experiment. (E) CETSA assay and density analysis of protein levels in control and CA (400 µM)-treated LPS-induced BV2 cells, n = 3, ** p < 0.01, *** p < 0.001 vs. control group. CETSA, the Cellular Thermal Shift Assay

Article Snippet: Complementary oligonucleotides sequences of ACOD1 SiRNAs (CCGTCATTCTTTCCAGTAT) were synthesized by Ribobio.

Techniques: Biomarker Discovery, Western Blot, Labeling, Recombinant, Immunofluorescence, Staining, Control, Thermal Shift Assay

Journal: Cell Communication and Signaling : CCS

Article Title: Activity-based chemical proteomics reveals caffeic acid ameliorates pentylenetetrazol-induced seizures by covalently targeting aconitate decarboxylase 1

doi: 10.1186/s12964-024-01739-y

Figure Lengend Snippet: CA covalently binds to ACOD1 and effects its enzymatic activity. (A-B) The content (A) and enzymatic activities (B) of ACOD1 in BV2 cells after treated with different dose of CA, n = 5. (C) Labeling of recombinant ACOD1 with CA-P and IAA competitor. (D) Labeling of recombinant ACOD1 with IAA-yne and CA competitor. (E) Molecular docking model of CA with ACOD1 visualized by molecular docking. IAA, Iodoacetamide; IAA-yne, iodoacetamide-alkyne. ** p < 0.01, *** p < 0.001 vs. control group

Article Snippet: Complementary oligonucleotides sequences of ACOD1 SiRNAs (CCGTCATTCTTTCCAGTAT) were synthesized by Ribobio.

Techniques: Activity Assay, Labeling, Recombinant, Control

Journal: Cell Communication and Signaling : CCS

Article Title: Activity-based chemical proteomics reveals caffeic acid ameliorates pentylenetetrazol-induced seizures by covalently targeting aconitate decarboxylase 1

doi: 10.1186/s12964-024-01739-y

Figure Lengend Snippet: CA suppressed neuroinflammation through NF-κB pathway. (A) The expression levels and densitometry analysis of proteins in BV2 cells after treated with or without CA for 48 h, n = 3, *** p < 0.001 vs. model group. (B) The levels of NO in BV2 cells with CA (100 µM) and SiRNA against ACOD1, n = 5. (C) The levels of TNF-α in BV2 cells with CA (100 µM) and ACOD1 SiRNA, n = 5. (D) Elisa assay of enzymatic activity in BV2 cells after treated with CA (100 µM) and ACOD1 SiRNA, n = 5. (E) Expression and densitometry analysis of ACOD1, TNF-α, p-PERK as well as NF-κB-p65 in LPS-treated BV2 cells after transfected with a plasmid of ACOD1 SiRNA and treated with CA (100 µM) for 48 h, n = 3. ns, not significant, ** p < 0.01, *** p < 0.001 in B-E.

Article Snippet: Complementary oligonucleotides sequences of ACOD1 SiRNAs (CCGTCATTCTTTCCAGTAT) were synthesized by Ribobio.

Techniques: Expressing, Enzyme-linked Immunosorbent Assay, Activity Assay, Transfection, Plasmid Preparation

Journal: Cell Communication and Signaling : CCS

Article Title: Activity-based chemical proteomics reveals caffeic acid ameliorates pentylenetetrazol-induced seizures by covalently targeting aconitate decarboxylase 1

doi: 10.1186/s12964-024-01739-y

Figure Lengend Snippet: Illustration of this study. CA ameliorate PTZ-induced seizures and showed anti-neuroinflammation effect in vivo and in vitro. Besides, ABPP strategy was used to identify the direct target of CA. Moreover, CA exhibited anti-neuroinflammation via ACOD1 mediated PERK-NF-κB pathway

Article Snippet: Complementary oligonucleotides sequences of ACOD1 SiRNAs (CCGTCATTCTTTCCAGTAT) were synthesized by Ribobio.

Techniques: In Vivo, In Vitro

Journal: bioRxiv

Article Title: Replication-dependent histone (Repli-Histo) labeling dissects the physical properties of euchromatin/heterochromatin in living human cells

doi: 10.1101/2024.10.20.618801

Figure Lengend Snippet: a , Validation of RIF1-KD by immunostaining (2 nd row) and the replication patterns visualized by Repli-Histo and EdU-pulse labeling (3 rd and 4 th rows). See for the description of the labeling patterns. b , Quantifications of RIF1 intensity in ( a ); n = 159 cells for siControl and n = 297 cells for RIF1-KD. ***: P = 6.0 × 10 -69 by two-sided Mann-Whitney U-test. c , The percentage of each Repli-Histo labeling pattern (IA/IB/II/III or ambiguous pattern). Note that ambiguous replication patterns with dispersed (or uniform) replicated regions appear in RIF1-KD cells. d , The log-log plot of MSDs from the plot of . The plots were fitted linearly. The anomalous exponents calculated from the fitted lines are shown. e , Motion angle distributions of nucleosomes in Class IA (control, n = 43; RIF1-KD, n = 27), IB (control, n = 35; RIF1-KD, n = 22), II (control, n = 40; RIF1-KD, n = 24), III (control, n = 19; RIF1-KD, n = 23), and ambiguous patterns (RIF1-KD, n = 72) in living HeLa cells. Their AC values are shown at the bottom. f , MSD plots (± SD among cells) of genome-wide-labeled single nucleosomes (H2B-Halo) in HeLa cells with indicated conditions: siControl, black; RIF1-depleted (siRIF1), red; n =21 cells for siControl and 17 cells for siRIF1. *: P = 0.046 by Kolmogorov-Smirnov test (two-sided).

Article Snippet: The siRNA oligonucleotide targeting RIF1 sequence (Invitrogen; Sense: 5’-GAAUGAGCCCCUAGGGAAATT-3’) was used.

Techniques: Immunostaining, Labeling, MANN-WHITNEY, Control, Genome Wide

Journal: bioRxiv

Article Title: Replication-dependent histone (Repli-Histo) labeling dissects the physical properties of euchromatin/heterochromatin in living human cells

doi: 10.1101/2024.10.20.618801

Figure Lengend Snippet: a , Schematic of the three-color Repli-Histo labeling for single-nucleosome imaging. Parental H3.2-Halo was labeled with green R110-direct HaloTag ligands. The remaining H3.2-Halo were then blocked with 7BRO, followed by pulse labeling with the two HaloTag ligands (TMR/JF646). b , Representative control (siControl) and RIF1-depleted (siRIF1) HeLa cells with the three-color Repli-Histo labeling. 1 st row: parental H3.2-Halo labeled with R110, identifying the S phase stage or replication timing; 2 nd and 3 rd rows: the Repli-Histo labeling patterns (TMR) and corresponding single-nucleosomes (JF646); 4 th row: the displacement of single nucleosomes as 2D heatmaps. See for the description of the labeling patterns. c , MSD plots (± SD among cells) of single nucleosomes in Class IA (red; siControl, n = 43; siRIF1, n = 27), IB (orange; siControl, n = 35; siRIF1, n = 22), II (green; siControl, n = 40; siRIF1, n = 24), and III (blue; siControl, n = 19; siRIF1, n = 23), and ambiguous patterns (grays; iControl, n = 0; siRIF1, n = 72) in siRIF1 (solid lines) or siControl (dashed lines) cells from 0.05 to 0.5 s. MSD exponents and AC values from are also shown in the brackets. d , MSD values at 0.5 s in each cell from ( c ). Black, siControl; Red, siRIF1. For siControl, ***: P = 5.6 × 10 -10 for Class IA versus IB, P = 1.9 × 10 -8 for Class IB versus II, and P = 1.6 × 10 -8 for Class II versus III by the two-sided Kolmogorov-Smirnov test. For siRIF1, **: P = 0.0012 for Class IA versus IB, P = 0.0035 for Class II versus III, and ***: P = 5.7 × 10 -10 for ambiguous patterns versus Class II. **: P = 3.2 × 10 -9 for Class IB versus II. N.S.: P = 0.70 for Class IB versus ambiguous patterns, by the two-sided Kolmogorov-Smirnov test. e , Correlation between MSD values at t = 0.5 s and R110 signals (i.e., DNA content at the time of Repli-Histo labeling). The bold “X” and bars show each stage’s mean and SD (also shown in the bottom plots). Spearman’s correlation coefficients among all cells are ρ = -0.67 for siControl and ρ = -0.57 for siRIF1.

Article Snippet: The siRNA oligonucleotide targeting RIF1 sequence (Invitrogen; Sense: 5’-GAAUGAGCCCCUAGGGAAATT-3’) was used.

Techniques: Labeling, Imaging, Control